(Journal of Leukocyte Biology. 2002;72:35-42.)
© 2002
by Society for Leukocyte Biology
CD137 is expressed by follicular dendritic cells and costimulates B lymphocyte activation in germinal centers
Susanne Pauly*,
Karin Broll*,
Margarethe Wittmann*,
Gerhard Giegerich
and
Herbert Schwarz*
* Departments of Pathology and
Neurology, University of Regensburg, Germany
Correspondence: Herbert Schwarz, Xenova Research Ltd., 310 Cambridge Science Park, Cambridge CB4 OWG, U.K. E-mail: herbert_schwarz{at}xenova.co.uk
 |
ABSTRACT
|
|---|
CD137, a member of the TNF receptor family, and its ligand are expressed on T lymphocytes and antigen-presenting cells (APC), respectively. During interaction with APC, T lymphocytes receive a potent, costimulatory signal through CD137. Reverse signaling has been demonstrated for the CD137 ligand, which causes activation in monocytes. Here we show that B lymphocytes also receive costimulatory signals through the CD137 ligand. Immobilized CD137 augmented proliferation of preactivated B lymphocytes up to fivefold and immunoglobulin synthesis, up to threefold. CD137 had no effect on resting cells. Further, we show that CD137 is expressed in vivo by follicular dendritic cells (FDC) in germinal centers. Germinal centers form during humoral immune responses and are essential for B lymphocyte affinity maturation. These data imply that, similar to the CD40 receptor/ligand system, which mediates T lymphocyte help to B lymphocytes after the first antigen encounter, the CD137 receptor/ligand system may mediate costimulation of B lymphocytes by FDC during affinity maturation.
Key Words: antigen-presenting cells hematoxylin/eosin Staphylococcus aureus
 |
INTRODUCTION
|
|---|
The humoral immune response is based on antigen-specific antibodies produced by B lymphocytes. Naive B lymphocytes recognize an antigen via antibodies retained at the cell surface leading to activation and the release of soluble antibodies of the immunoglobulin (Ig)M isotype. In cases of antigens without repetitive epitopes, activation is dependent and is enhanced further by helper T lymphocytes, and this process occurs mainly in the T lymphocyte areas of lymphoid follicles. After initial activation, B lymphocytes move to the centers of lymphoid follicles, creating germinal centers that consist of a framework of follicular dendritic cells (FDC) and activated B and T lymphocytes. There, the B lymphocytes undergo extensive proliferation and affinity maturation, a process leading to variations in the antigen-binding domains of the antibodies and the successive selection of the clones with the highest affinity antibodies. In the germinal centers, the B lymphocytes also switch to other Ig classes, thereby creating antibodies with altered affinity to their antigen and different effector functions [1
, 2
].
FDC support B lymphocyte development and the humoral immune response in several ways. FDC have the capacity to retain the antigen on their surface in specialized structures called iccosomes, thereby providing a source for the selection of high-affinity clones [3
]. They also express costimulatory molecules, which deliver antigen-nonspecific signals to the B lymphocytes [2
]. Further, FDC participate in the elimination of B lymphocytes with low affinity antibodies [4
, 5
].
Proliferation of preactivated B lymphocytes can be substantially increased by FDC [6
]. For this costimulation, cell contact is required, and it is partly mediated by intercellular adhesion molecule-1 (ICAM-1) and lymphocyte function-associated antigen-1, expressed on FDC and B lymphocytes, respectively [7
]. CD11a, CD11b, and the antigen 8D6 have also been shown to participate in the interaction of the two-cell populations [8
9
10
]. Further, FDC express CD23 and interleukin (IL)-7, which induce differentiation of B lymphocytes to plasma cells and ensure their survival [11
, 12
]. However, additional molecules are likely to play a role in FDC-mediated, B lymphocyte costimulation.
CD137 (ILA/4-1BB) is a member of the tumor necrosis factor (TNF) receptor family and is expressed on activated T lymphocytes [13
, 14
]. Costimulation through CD137 delivers a potent, costimulatory signal to T lymphocytes, which is equivalent to and synergistic with the costimulatory signal through CD28 [15
]. The CD137 signal enhances T lymphocyte activity, enabling the immune system to eliminate tumors in mice [16
].
The CD137 ligand is expressed constitutively on B lymphocytes and other antigen-presenting cells (APC) [15
]. Bidirectional signal transduction has been demonstrated for the CD137 receptor/ligand system. Immobilized but not soluble CD137 (sCD137) protein induces activation, prolongation of survival, and proliferation in primary monocytes, another class of APC [11
12
13
14
15
16
17
18
19
20
].
Here we show that CD137 is expressed by FDC in germinal centers and that cross-linking the CD137 ligand on B lymphocytes enhances proliferation and Ig synthesis of B lymphocytes via reverse signaling. These data identify the CD137 receptor/ligand system as a potent regulator for B lymphocyte development and humoral immune responses.
 |
MATERIALS AND METHODS
|
|---|
Reagents
The following reagents were used: anti-CD137 antibody (clone BBK-2) from Biosource (Ratingen, Germany); anti-CD137, phycoerythrin (PE)-conjugated (clone 4B4-1) from Ancell (Laeufelingen, Switzerland); MOPC21 from Sigma Chemical Co. (Deisenhofen, Germany); mouse IgG, PE-conjugated from DAKO (Hamburg, Germany); mouse anti-human CD3 antibody (clone L28) from DAKO; rabbit anti-human CD20cy antibody (clone L26) from DAKO; mouse anti-human CD20 antibody, PE-conjugated (clone B-Ly1) from DAKO; mouse anti-human CD40 antibody (clone B-B20) from Laboserv (Staufenberg, Germany); and anti-FDC clone CNA.42 from DAKO. The anti-FDC antibody Wü was a gift from Dr. Greiner (University of Würzburg, Germany); recombinant human IL-4, from Immunocontact (Frankfurt/Main, Germany); Staphylococcus aureus cowan 1 (SAC) crude cell suspension of formalin-fixed, 10% net w/v, nonviable S. aureus, from Sigma Chemical Co.; and human IgG1 Fc protein, from Accurate Chemical and Scientific Corp. (Westbury, NY).
CD137-Fc fusion protein was produced in Chinese hamster ovary cells. After transfection with a CD137-Fc (ILA-IgG) expression vector, the cells were selected in 0.6 mg/ml geneticin [21
]. CD137-Fc protein was purified from supernatants by protein A sepharose.
Cells and cell culture
The FDC-like cell line FDC-H1 was a generous gift from Dr. Feller, University of Lübeck (Germany). It is a hybrid cell line generated by a fusion of enriched FDC from human tonsils with the murine myeloma cell line SP2/0-Ag14 and constantly expresses surface antigens and a cytokine profile characteristic of FDC [22
].
Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats of healthy volunteers. Buffy coats were diluted with 2 equal volumes of phosphate-buffered saline (PBS), overlaid onto an equal volume of Histopaque (Sigma Chemical Co.), and spun for 20 min at 1200 g. PBMC, which accumulated as a white layer at the Percoll boundary, were recovered, and erythrocytes were lysed with 2 ml 200 mM NH4Cl, 10 mM NaHCO3, 10 mM ethylenediaminetetraacetate, pH 7.4, for 2 min at room temperature (RT). Cells were washed two times with PBS, pelleted at 250 g, and resuspended in RPMI, 5% fetal calf serum (FCS).
The B lymphocytes fraction (IB1) in PBMC was enriched by elutriation [23
] and contained between 60% and 80% B lymphocytes as estimated by CD19 expression. The remaining cells were T lymphocytes as determined by CD3 expression.
Immunhistochemistry
Frozen tissue sections were fixed with 2% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by 2% hydrogen peroxide in methanol for 15 min. Unspecific staining was blocked by 3% dry milk in PBS for 30 min. Anti-CD137 (2 µg/ml; clone BBK-2, Biosource) or an isotype-control antibody (MOPC 21, Sigma Chemical Co.) in 3% dry milk was added overnight. Positive hybridization was detected by the ABC staining kit (DAKO) at 37°C using diaminobenzidine as substrate. After each step, the samples were washed three times with PBS. Tissue sections were stained with hematoxylin and embedded in Entellan (Merck, Darmstadt, Germany).
For double staining, frozen tissue sections were fixed with ice-cold acetone for 10 min, air-dried, and then rehydrated with PBS for 5 min. Anti-CD137 (2 µg/ml; clone BBK-2) and 2.8 µg/ml anti-FDC (DAKO) were added for 2 h at RT. Sections were incubated simultaneously with 13 µg/ml Cy3-conjugated goat anti-mouse IgM and 3.75 µg/ml fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (both from Jackson Laboratories, Bar Harbor, ME) for 1 h at RT. Subsequently, the sections were counterstained with 4 µg/ml Hoechst 33342 (Sigma Chemical Co.) for 30 min at 37°C. After each step, the sections were washed three times with PBS and were finally embedded with H-1000 (Linaris GmbH, Wertheim, Germany).
Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated using RNAzol B (Tel-Test, Inc., Friendswood, TX), and up to 5 µg RNA was reverse-transcribed in a 20 µl volume, using random hexanucleotide primers (50 µg/ml), 25 µM dNTP, 10 mM dithiothreitol, 200 units SuperScriptTMII RNaseH-RT (BRL, Eggenstein, Germany), and 20 units RNAsin (Roche, Mannhein, Germany) for 60 min at 42°C.
The RT reaction (2 µl) served as a template for the subsequent PCR, which was performed in a 20 µl volume with 1 unit Taq DNA polymerase (Roche), 200 µM dNTP, 1.5 mM MgCl2, 10 mM Tris, pH 8.3, 50 mM KCl, and 10 µM each primer. After a 5-min denaturation step at 94°C, the reaction proceeded in 35 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, followed by 10 min at 72°C.
Primers used were: CD137 sense, 5' ATCATGGGAAACAGCTGTTACAAC, position, minus 321; CD137 antisense, 5' TGGTCCACAGACCACGTCCCTCTC, position, 480457; G3PDH sense, 5' TGGTATCGTGGAAGGACTCATGAC; and G3PDH antisense, 5' ATGCCAGTGAGCTTCCCGTTCAGC.
Enzyme-linked immunosorbent assay (ELISA)
A specific ELISA using a matched set of IgM-specific antibodies and the protocol provided by the manufacturer (Pharmingen, Hamburg, Germany) was used to determine concentrations of IgM in cell supernatants. For coating, mouse anti-human IgM (clone JDC-15) at 2 µg/ml and for detection, mouse anti-human IgM biotin (clone G20-127) at 6 µg/ml were used. The concentration of sCD137 was determined as described previously [24
].
Cell proliferation
Proliferation of cell populations was determined in a 96-well microtiter plate. PBMC (2x105) or IB1 cells per well in a 100 µl volume were pulsed for 24 h with 0.5 µCi; 3H-thymidine at day 2 and were harvested and evaluated on the TopCount microplate scintillation counter (Packard, Meriden, CT). Each condition was performed in triplicate and depicted as means ± SD.
CFSE [5 (and 6-)-carboxyfluorescein diacetate succinimidyl ester] labeling
IB1 cells (1x107/ml) were washed three times with PBS. In dimethyl sulfoxide, CFSE (5 mM) was diluted to 5 µM in PBS and added to the cell for 10 min at 37°C. The reaction was stopped by adding 10% FCS-containing RPMI. The cells were washed two times in RPMI, 10% FCS.
Flow cytometry analysis
Cells were analyzed using a FACS-Calibur (Becton Dickinson, Mountain View, CA) and Cellquest software. One million cells were used per condition. Cells were washed in fluorescence-activated cell sorting (FACS) buffer (PBS, 2% FCS, 0.1% NaN3), resuspended in 50 µl FACS buffer, and stained with PE-conjugated anti-CD137 antibody, PE-conjugated isotype-control antibody (each 10 µg/ml), or PE-conjugated anti-CD20 antibody (dilution 1:25) for 30 min at 4°C. After two washes, cells were analyzed by flow cytometry.
 |
RESULTS
|
|---|
CD137 is expressed by FDC in germinal centers
Screening for CD137 expression in vivo by immunhistochemistry, we found strong CD137 staining in germinal centers of lymph follicles (Fig. 1A
). CD137-positive lymph follicles were not specific to certain organs, but were found in several different tissues. Lymph follicles could be identified in the lymph node and spleen, and they did contain CD137-positive cells in both tissues. Among the inflammatory tissues, 2 out of 6 contained CD137-positive lymph follicles, and in benign and malignant tumors, 1 out of 3 and 6 out of 11, respectively, stained positive for CD137. Tissues were classified as negative when no CD137 staining could be detected in the lymph follicles. However, the negative result may be a result of experimental coincidences such as the position of the tissue sections.

View larger version (176K):
[in this window]
[in a new window]
|
Figure 1. CD137 expression in germinal centers. (A) Serial frozen sections of a human lymph node were stained with antibodies specific for CD137 and an isotype-control antibody (control). Staining with HE was used for a better visualization of the tissue. Photographs were taken at an original magnification of 50x. (B) Close-up photography of a single germinal center (upper) stained for CD137 (brown) and counterstained with hematoxylin (blue) and of the CD137-positive fiber-like extensions (lower). Photographs were taken at an original magnification of 200x.
|
|
CD137 immunoreactivity coincided with the inner zone of germinal centers, which is composed of FDC and B lymphocytes undergoing affinity maturation (Fig. 1B)
. As the CD137-positive cells display long extensions, we suspected that the FDC were the ones expressing CD137 (Fig. 1B)
. To verify this assumption, we stained serial sections of a germinal center with hematoxylin/eosin (HE) and with antibodies specific for FDC, B lymphocytes (CD19), T lymphocytes (CD3), CD137, and an isotype control antibody (Fig. 2A
). The anti-CD137 and anti-FDC antibodies yielded almost identical staining patterns in the inner germinal center zone. Few CD137-positive cells were present in the outer zone, which was completely devoid of cells reacting with the anti-FDC antibody. The anti-CD19 antibody stained the entire germinal center, implying that the B lymphocytes were more or less homogeneously distributed throughout the inner and outer zone. T lymphocytes were found in the inner and outer zone, with a slight preference for the outer zone. The results from this experiment would be compatible with FDC expressing CD137 in the inner zone of the germinal center and with a few non-FDC expressing CD137 in the outer zone. The latter ones are most likely T lymphocytes.

View larger version (115K):
[in this window]
[in a new window]
|
Figure 2. CD137 is expressed by FDC. (A) Serial frozen sections of a germinal center in a tonsil were stained with antibodies specific for CD137 (CD137), FDC (Wü), B lymphocytes (CD19), T lymphocytes (CD3), and an isotype-control antibody (control). Staining with HE was used for visualization of the tissue. Photographs were taken at an original magnification of 200x. (B) A frozen section of a tonsil was stained simultaneously with antibodies specific for CD137 (green) and FDC (red) and for chromatin (blue). Areas of colocalization appear yellow (upper left panel; superimposition). Photographs were taken at an original magnification of 400x.
|
|
As an additional confirmation, double staining for CD137 and FDC was performed (Fig. 2B)
. CD137 was visualized by FITC (green) and FDC, by Cy3 (red). Areas of colocalization (yellow) clearly demonstrate that CD137 is expressed by the FDC. Chromatin was stained with Hoechst 33342 and appears blue.
The expression of CD137 in FDC was also confirmed using the FDC-derived cell line FDC-H1 [22
]. RT-PCR revealed constitutive expression of CD137 mRNA (Fig. 3A
). In accordance with these mRNA data, strong expression of CD137 protein was found on FDC-H1 cells by flow cytometry, and CD137 levels on FDC-H1 cells were higher than those on activated PBMC (Fig. 3B)
. Activated T lymphocytes can express membrane-bound as well as sCD137, the latter being encoded by differentially spliced mRNA isoforms [24
]. No sCD137 could be detected in the supernatants of FDC-H1 cells by ELISA, and no splice forms were detected by RT-PCR (ref [24
] and not shown).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. CD137 expression on FDC. (A) FDC-1 cells (106) were cultured for 16 h before expression of CD137 mRNA (upper panel) was evaluated by RT-PCR using the primers CD137-sense and CD137-antisense. The expected product is 460 bp. MWM, Molecular weight marker VI (Roche); H20, negative control; resting and activated (16 h, 20 ng/ml PMA+200 nM A23187) PBMC, negative and positive PCR controls, respectively. (B) CD137 cell surface expression on the FDC line FDC-H1 was assessed by flow cytometry. Cells (106) were used per condition, and the cells were not activated. White peak, solid line, Autofluorescence; white peak, stiched line, isotype control (mouse IgG, PE-conjugated); shaded peak, anti-CD137, PE-conjugated (clone 4B4-1).
|
|
CD137 costimulates B lymphocyte proliferation
FDC play a pivotal role in B lymphocyte affinity maturation, which commences with a strong expansion of the antigen-specific B lymphocyte population. Therefore, we tested whether CD137 influences B lymphocyte proliferation. Cell culture dishes were coated with a fusion protein consisting of the extracellular domain of CD137 and the constant domain of human IgG1 (Fc). Fc control protein-coated plates were used as controls. Coating was performed with a solution of 5 µg/ml CD137-Fc or Fc protein in PBS at 4°C overnight. CD137 alone was not able to induce proliferation of resting B lymphocytes (not shown). However, in SAC-preactivated cells, CD137 enhanced proliferation significantly (Fig. 4A
). Also, with the more physiological stimuli IL-4 + anti-CD40, CD137 increased B lymphocyte proliferation (Fig. 4A)
. As a further confirmation that CD137 costimulates B lymphocyte proliferation, cells were labeled with CFSE prior to activation with SAC and CD137. CFSE is a fluorescent dye, which nonspecifically attaches to cell surface proteins. CFSE fluorescence per cell gets diluted by cell division and provides a method to measure cell proliferation. As shown in Figure 4B
, only the CD20-positive cells divided, documented by a decreasing CFSE fluorescence, whereas the CD20-negative subpopulation remained unchanged.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. CD137 costimulates B lymphocyte proliferation. (A) Primary B lymphocytes (2x105) per well were activated by indicated concentrations of SAC or by anti-CD40 (5 µg/ml) + IL-4 (100 ng/ml) and were cultured on immobilized Fc or CD137-Fc protein (5 µg/ml). Cells were labeled at day 2 with 3H-thymidine, and proliferation was determined at day 3. Identical results were obtained in four independent experiments. (B) Primary B lymphocytes were labeled with CFSE, cultured on plates coated with CD137-Fc protein (5 µg/ml), and activated by SAC (1:1000). After 3 days, the cells were stained with anti-CD20 (left panel, y-axis). The forward-scatter (FSC-H1; x-axis) measures the size of the cells (the more to the right, the bigger). Cell blasts stain positive for CD20, a B lymphocyte-specific protein. The degree of cell division was determined by flow cytometry for the CD20-positive B lymphocytes (upper right panel) and the CD20-negative T lymphocytes (lower right panel). Shaded, filled, Nonactivated cells; solid, open, SAC-activated cells. Peaks marked by arrows represent cells that have completed one or two cell divisions since labeling. Identical results were obtained in three independent experiments.
|
|
CD137 enhances IgM expression in B lymphocytes
The primary task for B lymphocytes is the production of antibodies. Similar to proliferation, CD137 alone had no effect on IgM synthesis of resting B lymphocytes (Fig. 5
). Activation of the cells with SAC alone did induce significant IgM levels. The combination of SAC and CD137 enhanced IgM levels two- to threefold over those induced by SAC alone (Fig. 5)
.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5. CD137 costimulates IgM synthesis. Primary B lymphocytes (2x105) were activated by SAC (1:105) and cultured on immobilized Fc or CD137-Fc protein (5 µg/ml). Supernatants were collected at day 10, and the concentration of IgM was determined by ELISA. Identical results were obtained in five independent experiments.
|
|
 |
DISCUSSION
|
|---|
At contact with B lymphocytes, FDC form a dense network in the light zones of germinal centers. B lymphocytes undergo affinity maturation and selection in germinal centers, and FDC play an essential role in this process. Our discovery that FDC express CD137 in vivo and in vitro together with earlier data demonstrating expression of CD137 ligand on B lymphocytes [15
] suggested a role of the CD137 receptor/ligand system in the process of B lymphocyte affinity maturation. This hypothesis could be experimentally confirmed by demonstrating that CD137 augments proliferation and Ig synthesis by B lymphocytes.
The activities of CD137 and its ligand in B lymphocyte activation are reminiscent of that of a related receptor/ligand pair, also belonging to the TNF receptor and ligand families. The interaction of CD40 ligand on T lymphocytes with CD40 on B lymphocytes is essential for B lymphocyte expansion and the initiation of affinity maturation [25
]. The CD40 receptor/ligand system mediates T lymphocyte help to B lymphocytes, which have encountered their specific antigen for the first time (Fig. 6
). The B lymphocytes then migrate to germinal centers where they undergo affinity maturation and clonal selection. It can be hypothesized that at initial antigen encounter, the antigen is presented by the TCR of the helper T lymphocyte, and costimulation is provided by the CD40 receptor/ligand system. After somatic hypermutation of the complementary determining region, the second antigen encounter takes place on the surface of FDC in the form of iccosomes, and here, costimulation is mediated by the CD137 receptor/ligand system (Fig. 6)
.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6. Model of the CD40 and CD137 receptor/ligand systems in the costimulation of humoral immune responses.
|
|
Besides CD137, FDC express several other costimulatory molecules such as ICAM-1 and CD23. The multitude of costimulatory molecules may enable FDC to provide a more potent costimulation of B lymphocytes. However, it may also be that the individual costimulatory molecules are active during different stages or biased toward specific differentiation pathways of B lymphocytes and the humoral immune response.
B lymphocytes, which have generated higher affinity antibodies during affinity maturation will become positively selected and will expand and leave the germinal center. However, affinity maturation also generates B lymphocytes with lower affinity antibodies, and these B lymphocytes will be eliminated through apoptosis initiated by CD95 ligand on FDC [26
, 27
]. As CD137 induces expression of CD95 in B lymphocytes [28
], it is possible that CD137 also participates in the elimination of B lymphocytes with low affinity antibodies.
The absence of sCD137 in supernatants of the FDC-derived cell line FDC-H1 and the inability to detect the mRNA splice form encoding sCD137 indicate that FDC only express the membrane-bound isoform of CD137 but not sCD137. As sCD137 is antagonistic, FDC seem to use CD137 solely to deliver an activating signal to B lymphocytes. In contrast, T lymphocytes can express both CD137 isoforms and switch from expressing the agonistic membrane-bound CD137 to the antagonistic sCD137 when their activation status is very high, limiting immune reactions and avoiding activation-induced cell death [29
].
During germinal center formation, FDC not only deliver but also receive signals. FDC express CD40, and their interaction with CD40 ligand-expressing T lymphocytes stimulates cytokine release by FDC [30
]. CD137 ligand is expressed by B lymphocytes and other APC. At T and B lymphocyte interactions, T lymphocytes receive a costimulatory signal through CD137, which enhances proliferation and cytolytic activity [15
, 21
, 31
]. It is therefore possible that FDC also receive a signal through their surface-expressed CD137 when they interact with B lymphocytes. Bidirectional transduction of costimulatory signals through the receptor as well as the ligand has also been described for the OX40, CD40, and CD30 receptor/ligand systems, three other members of the TNF receptor and ligand families [32
33
34
].
CD137 not only enhances the activity of B lymphocytes: immobilized CD137 protein has been shown to induce activation, prolongation of survival, and proliferation of monocytes [17
18
19
20
]. Therefore, reverse signaling through the CD137 ligand seems to be a general activating signal for APC. However, although the signal through CD137 was sufficient for activation of monocytes, it had no effect on B lymphocytes on its own, but CD137 enhanced the activity of preactivated B lymphocytes.
Recently, evidence of CD137 ligand-transducing signals into APC has also been obtained in vivo [35
]. Constitutive expression of CD137 ligand on APC of transgenic mice led to the elimination of peripheral B cells and an increase in monocyte numbers. The augmentation of monocytes in vivo matches well the induction of monocyte proliferation by immobilized CD137 in vitro. However, the depletion of B cell stands seems to contrast our in vitro findings that CD137 ligand signaling enhances B cell proliferation and activity. The reason for this difference is not known. One possible explanation may be that the CD137 ligand signal is sufficient for monocytes to become activated and to proliferate, and the CD137 ligand signal is only costimulatory for B cells, and B cells require another signal (for example, through the B cell receptor). The CD137 ligand-transgenic mice have normal B cell numbers and functions up to the age of 3 months and develop B cell deficiencies only later in life. This indicates that only prolonged CD137 ligand signals may be deleterious for B cell numbers and functions.
Expression of CD137 in lymph follicles is easily detectable by immunhistochemistry, and strong staining signals are obtained in the FDC-containing light zone. This stands in contrast to activated T lymphocytes, from where human CD137 was originally cloned [13
]. CD137-positive T lymphocytes are hardly detectable by immunhistochemistry, even in inflamed tissues, suggesting a significantly higher expression of CD137 on FDC compared with activated T lymphocytes. This is supported by the flow cytometry analysis of FDC, which shows about two order-of-magnitude higher staining with the anti-CD137 antibody compared with the isotype control (Fig. 2B)
. In activated T lymphocytes, this difference was just one order of magnitude [21
, 29
].
Only few cells were detected in germinal centers, which expressed CD137 and were not FDC (Fig. 2A)
. However, activated T lymphocytes, which can express CD137, are present in significantly larger numbers in germinal centers. An explanation could be that only a limited number of T lymphocytes are specific for a certain antigen, and only those would interact with APC and receive activating signals. It may be that only these T lymphocytes, and only in a specific activation state, express CD137. A contributing factor could be that CD137 is expressed predominantly on CD8-positive T lymphocytes and to a lesser extent, on CD4-positive ones, which are the ones populating the germinal centers. The larger numbers of CD137-positive T lymphocytes found by flow cytometry likely reflect an artificial, in vitro situation where T lymphocytes were stimulated unspecifically by polyclonal activators.
Expression of CD137 was detected in most but not all lymph follicles. The most likely explanation for finding CD137-negative lymph follicles may be experimental coincidences, i.e., tissue sections, which were cut above or below the inner zone containing the FDC. Another possibility is that the negative follicles represent primary follicles where germinal centers are not yet formed. However, it cannot be ruled out that CD137 may not be expressed in every germinal center.
The CD137 receptor/ligand system has been associated with a cytotoxic immune response as a result of higher expression on CD8-positive T lymphocytes than on CD4-positive ones [36
]. Also, anti-CD137 antibodies and recombinant CD137 ligand induce strong, cell-mediated, immune responses against tumors and allogeneic transplants [16
, 37
]. The data presented here indicate that CD137 and its ligand also play an important role in humoral immune responses.
 |
ACKNOWLEDGEMENTS
|
|---|
This work was supported by the Deutsche Forschungsgemeinschaft. We thank Gitte Krause for excellent technical assistance; Dr. Greiner, University of Würzburg, Germany, for an anti-FDC antibody; and Dr. Feller, University of Lübeck, Germany, for FDC-H1 cells.
Received August 29, 2001;
revised January 31, 2002;
accepted February 6, 2002.
 |
REFERENCES
|
|---|
- Kosco, M. H., Gray, D. (1992) Signals involved in germinal center reactions Immunol. Rev. 126,63-76[Medline]
- Tew, J. G., Wu, J., Qin, D., Helm, S., Burton, G. F., Szakal, A. K. (1997) Follicular dendritic cells and presentation of antigen and costimulatory signals to B cells Immunol. Rev. 156,39-52[Medline]
- Wu, J., Qin, D., Burton, G. F., Szakal, A. K., Tew, J. G. (1996) Follicular dendritic cell-derived antigen and accessory activity in initiation of memory IgG responses in vitro J. Immunol. 157,3404-3411[Abstract]
- Choi, J., Kim, H. S., Zhang, X., Armitage, R. J., Choi, Y. S. (1996) Cellular and molecular factors that regulate the differentiation and apoptosis of germinal center B cells. Anti-Ig down-regulates Fas expression of CD40 ligand-stimulated germinal center B cells and inhibits Fas-mediated apoptosis J. Immunol. 157,1006-1016[Abstract]
- Koopman, G., Keehnen, R. M., Lindhout, E., Zhou, D. F., de Groot, C., Pals, S. T. (1997) Germinal center B cells rescued from apoptosis by CD40 ligation or attachment to follicular dendritic cells, but not by engagement of surface immunoglobulin or adhesion receptors, become resistant to CD95-induced apoptosis Eur. J. Immunol. 27,1-7[Medline]
- Burton, G. F., Conrad, D. H., Szakal, A. K., Tew, J. G. (1993) Follicular dendritic cells and B cell costimulation J. Immunol. 150,31-38[Abstract]
- Kosco, M. H., Pflugfelder, E., Gray, D. (1992) Follicular dendritic cell-dependent adhesion and proliferation of B cells in vitro J. Immunol. 148,2331-2339[Abstract]
- Li, L., Zhang, X., Kovacic, S., Long, A. J., Bourque, K., Wood, C. R., Choi, Y. S. (2000) Identification of a human follicular dendritic cell molecule that stimulates germinal center B cell growth J. Exp. Med. 191,1077-1084[Abstract/Free Full Text]
- Ogata, T., Yamakawa, M., Imai, Y., Takahashi, T. (1996) Follicular dendritic cells adhere to fibronectin and laminin fibers via their respective receptors Blood 88,2995-3003[Abstract/Free Full Text]
- Clark, E. A., Grabstein, K. H., Shu, G. L. (1992) Cultured human follicular dendritic cells. Growth characteristics and interactions with B lymphocytes J. Immunol. 148,3327-3335[Abstract]
- Liu, Y. J., Cairns, J. A., Holder, M. J., Abbot, S. D., Jansen, K. U., Bonnefoy, J. Y., Gordon, J., MacLennan, I. C. (1991) Recombinant 25-kDa CD23 and interleukin 1 alpha promote the survival of germinal center B cells: evidence for bifurcation in the development of centrocytes rescued from apoptosis Eur. J. Immunol. 21,1107-1114[Medline]
- Kroncke, R., Loppnow, H., Flad, H. D., Gerdes, J. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction Eur. J. Immunol. 26,2541-2544[Medline]
- Schwarz, H., Tuckwell, J., Lotz, M. (1993) A receptor induced by lymphocyte activation ILA: a new member of the human nerve growth factor/tumor necrosis factor receptor family Gene 134,295-298[Medline]
- Schwarz, H., Valbracht, J., Tuckwell, J., Kempis, J., Lotz, M. (1995) ILA, the human 4-1BB homologue is inducible in lymphoid and other cell lines Blood 85,1043-1052[Abstract/Free Full Text]
- DeBenedette, M. A., Chu, N. R., Pollok, K. E., Hurtado, J., Wade, W. F., Kwon, B. S., Watts, T. H. (1995) Role of 4-1BB ligand in costimulation of T lymphocyte growth and its upregulation on M12 B lymphomas by cAMP J. Exp. Med. 181,985-992[Abstract/Free Full Text]
- Melero, I., Shuford, W. W., Newby, S. A., Aruffo, A., Ledbetter, J. A., Hellström, K. E., Mittler, R. S., Chen, L. (1997) Monoclonal antibodies against 4-1BB T cell activation molecule eradicate established tumors Nat. Med. 3,682-685[Medline]
- Langstein, J., Michel, J., Fritsche, J., Kreutz, M., Andreesen, R., Schwarz, H. (1998) CD137 (ILA/4-1BB), a member of the TNF receptor family, regulates monocyte activation via reverse signaling J. Immunol. 160,2488-2494[Abstract/Free Full Text]
- Langstein, J., Schwarz, H. (1999) Identification of CD137 as a potent monocyte survival factor J. Leukoc. Biol. 65,829-833[Abstract]
- Langstein, J., Michel, J., Schwarz, H. (1999) CD137 induces proliferation and endomitosis in monocytes Blood 94,3161-3168[Abstract/Free Full Text]
- Langstein, J., Becke, F. M., Soellner, L., Krause, G., Brockhoff, G., Kreutz, M., Andreesen, R., Schwarz, H. (2000) Comparative analysis of CD137 and LPS effects on monocyte activation, survival, and proliferation Biochem. Biophys. Res. Commun. 273,117-122[Medline]
- Schwarz, H., Blanco, F., Valbracht, J., Kempis, J., Lotz, M. (1996) ILA, a member of the human NGF/TNF receptor family, regulates T lymphocyte proliferation and survival Blood 87,2839-2845[Abstract/Free Full Text]
- Orscheschek, K., Merz, H., Schlegelberger, B., Feller, A. C. (1994) An immortalized cell line with features of human follicular dendritic cells. Antigen and cytokine expression analysis Eur. J. Immunol. 24,2682-2690[Medline]
- Andreesen, R., Brugger, W., Scheibenbogen, C., Kreutz, M., Leser, H. G., Rehm, A., Lohr, G. W. (1990) Surface phenotype analysis of human monocyte to macrophage maturation J. Leukoc. Biol. 47,490-497[Abstract]
- Michel, J., Langstein, J., Hofstädter, F., Schwarz, H. (1998) A soluble form of CD137 (ILA/4-1BB) is released by activated lymphocytes and is detectable in sera of patients with rheumatoid arthritis Eur. J. Immunol. 28,290-295[Medline]
- Kehry, M. R., Hodgkin, P. D. (1993) Helper T cells: delivery of cell contact and lymphokine-dependent signals to B cells Semin. Immunol. 5,393-400[Medline]
- Hollmann, C., Gerdes, J. (1999) Follicular dendritic cells and T cells: nurses and executioners in the germinal centre reaction J. Pathol. 189,147-149[Medline]
- Hur, D. Y., Kim, D. J., Kim, S., Kim, Y. I., Cho, D., Lee, D. S., Hwang, Y., Bae, K., Chang, K. Y., Lee, W. J. (2000) Role of follicular dendritic cells in the apoptosis of germinal center B cells Immunol. Lett. 72,107-111[Medline]
- Michel, J., Langstein, J., Krammer, P., Schwarz, H. (1999) CD137-induced apoptosis is independent of CD95 Immunology 98,42-46[Medline]
- Michel, J., Schwarz, H. (2000) Soluble CD137 is selectively expressed by T lymphocytes and correlates with activation induced cell death of lymphocytes Cytokine 12,742-746[Medline]
- Park, S. M., Kim, H. S., Choe, J., Lee, T. H. (1999) Differential induction of cytokine genes and activation of mitogen-activated protein kinase family by soluble CD40 ligand and TNF in a human follicular dendritic cell line J. Immunol. 163,631-638[Abstract/Free Full Text]
- Alderson, M. R., Smith, C. A., Tough, T. W., Davis-Smith, T., Armitage, R. J., Falk, B., Roux, E., Baker, E., Sutherland, G. R., Din, W. S., Goodwin, R. G. (1994) Molecular and biological characterization of human 4-1BB and its ligand Eur. J. Immunol. 24,2219-2227[Medline]
- Stuber, E., Neurath, M., Calderhead, D., Fell, H. P., Strober, W. (1995) Cross-linking of OX40 ligand, a member of the TNF/NGF cytokine family, induces proliferation and differentiation in murine splenic B cells Immunity 2,507-521[Medline]
- van Essen, D., Kikutani, H., Gray, D. (1995) CD40 ligand-transduced co-stimulation of T cells in the development of helper function Nature 378,620-623[Medline]
- Wiley, R. W., Goodwin, R. G., Smith, C. A. (1996) Reverse signaling via CD30 ligand J. Immunol. 157,3635-3639[Abstract]
- Zhu, G., Flies, D. B., Tamada, K., Sun, Y., Rodriguez, M., Fa, Y-X., Chen, L. (2001) Progressive depletion of peripheral B lymphocytes in 4-1BB (CD137) ligand/I-E
-transgenic mice J. Immunol. 167,2671-2676[Abstract/Free Full Text]
- Takahashi, C., Mittler, R. S., Vella, A. T. (1999) Cutting edge: 4-1BB is a bona fide CD8 T cell survival signal J. Immunol. 162,5037-5040[Abstract/Free Full Text]
- Shuford, W. W., Klussman, K., Tritchler, D. D., Loo, D. T., Chalupny, J., Siadak, A. W., Brown, T. J., Emswiler, J., Raecho, H., Larsen, C. P., Pearson, T. C., Ledbetter, J. A., Aruffo, A., Mittler, R. S. (1997) 4-1BB costimulatory signals preferentially induce CD8+ T cell proliferation and lead to the amplification in vivo of cytotoxic T cell responses J. Exp. Med. 186,47-55[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. Jiang, Y. Chen, and H. Schwarz
CD137 Induces Proliferation of Murine Hematopoietic Progenitor Cells and Differentiation to Macrophages
J. Immunol.,
September 15, 2008;
181(6):
3923 - 3932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Jiang, P. S. E. Yue, D. Drenkard, and H. Schwarz
Induction of Proliferation and Monocytic Differentiation of Human CD34+ Cells by CD137 Ligand Signaling
Stem Cells,
September 1, 2008;
26(9):
2372 - 2381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Olofsson, L. A. Soderstrom, D. Wagsater, Y. Sheikine, P. Ocaya, F. Lang, C. Rabu, L. Chen, M. Rudling, P. Aukrust, et al.
CD137 Is Expressed in Human Atherosclerosis and Promotes Development of Plaque Inflammation in Hypercholesterolemic Mice
Circulation,
March 11, 2008;
117(10):
1292 - 1301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sun and P. J. Fink
A New Class of Reverse Signaling Costimulators Belongs to the TNF Family
J. Immunol.,
October 1, 2007;
179(7):
4307 - 4312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Drenkard, F. M. Becke, J. Langstein, T. Spruss, L. A. Kunz-Schughart, T. E. Tan, Y. C. Lim, and H. Schwarz
CD137 is expressed on blood vessel walls at sites of inflammation and enhances monocyte migratory activity
FASEB J,
February 1, 2007;
21(2):
456 - 463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sun, S. E. Blink, J. H. Chen, and Y.-X. Fu
Regulation of Follicular Dendritic Cell Networks by Activated T Cells: The Role of CD137 Signaling
J. Immunol.,
July 15, 2005;
175(2):
884 - 890.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Schwarz
Biological activities of reverse signal transduction through CD137 ligand
J. Leukoc. Biol.,
March 1, 2005;
77(3):
281 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kirchner, S. Boldt, W. Kolch, S. Haffner, S. Kazak, P. Janosch, E. Holler, R. Andreesen, and G. Eissner
LPS resistance in monocytic cells caused by reverse signaling through transmembrane TNF (mTNF) is mediated by the MAPK/ERK pathway
J. Leukoc. Biol.,
February 1, 2004;
75(2):
324 - 331.
[Abstract]
[Full Text]
[PDF]
|
 |
|